Please select your current year level
PLEASE SELECT 789101112

Please select your school's state
PLEASE SELECT QLDVICWANSWSATAS

Entries open May 1st, and close June 30th 2010. The winner and runner up in each category (Year 7-9 and Year 10-12) will receive a prize (iPods, Book vouchers etc. up for grabs - depending on state).

Top ranking entries in each category will also receive a certificate of merit.

You and your science teacher will be notified if you win.

Your science teacher or if requested a representative of ASMR will present you with your prize and certificate.

The Quiz is a 20 question multiple choice quiz that will test your knowledge, exercise your mind and inspire your imagination.

The quiz can only be attempted once by each entrant.

Once you have begun, you must complete the quiz in a single session. Good luck!

The Medical Research Quiz is just one part of ASMR Medical Research Week® 2010.

Go to www.asmr.org.au to find out about the other exciting medical research related activities you can participate in.

Here is a list of some generic health, science and medical research websites that you might find useful when completing the quiz:

http://www.betterhealth.vic.gov.au/

http://www.abs.gov.au/

http://www.health.gov.au

http://www.abc.net.au/science

http://www.science.org.au/nova/index.htm

http://en.wikipedia.org/wiki/Main_Page

http://www.howstuffworks.com/

Western Australian Medical Researchers Prof Barry Marshall and Dr Robin Warren won the 2005 Nobel Prize in Physiology or Medicine for their discovery that stomach ulcers were caused by:

A) Stress
B) Acidic Foods
C) Bacteria
D) Fatty Foods

Which Australian did not win the noble prize in the category “physiology or medicine”?

A) Peter Doherty
B) Sir Frank MacFarlen Burnet
C) Sir John Carew Eccles
D) Sir John Warcup Cornforth
E) Elizabeth H. Blackburn

Geometry may be used to decide a stem cells fate. Culturing bone marrow in certain shaped moulds can influence how a cell differentiates. Which of the following is likely to produce more osteoblasts then adipocytes

A) Square
B) Flower
C) Star
D) Circle

Induced Pluripotent stem cells may one day be used to repair damaged nerve, heart or pancreatic tissue curing diseases such as Alzheimers, heart attack or diabetes. Induced pluripotent stem cells are made by introducing which 4 genes into patient skin cells

Answer A) Nanog, Oct4, Myc, Sox2
Answer B) Oct4, Myc, Sox2, Fbx15
Answer C) Myc, Sox2, Fbx15, Klf4
Answer D) Sox2, Oct4, Myc, Klf4

What gene does this peptide sequence come from? MVHLTDAEKAAVSGLW

A) beta globin
B) alpha globin
C) fetal globin
D) albumin

What gene DNA sequence encodes this peptide? MSVGLPGPHS

A) ATGAGTGTGGGTCTTCCTGGTTCCCACAGT
B) ATGAGTGTGCGTCTTCCTGGTCCCCACAGT
C) ATGAGTGTGGGTCTTTCTGGTCCCCACAGT
D) ATGAGTGTGGGTCTTCCTGGTCCCCACAGT

What was the first Australian marsupial to have it’s genome sequenced?

A) Monodelphis domestica
B) Macropus eugenii
C) Macropus giganteus
D) Phascolarctos cinereus

When was the first human chromosome (chromosome 22) first completely sequenced?

A) 1999
B) 1991
C) 2008
D) 2005

Deep brain stimulation functional neurosurgery is a novel method used to treat Parkinson's disease patients. What is the most recently targeted brain area for deep brain stimulation to treat Parkinson's disease patients with significant symptoms of freezing of gait and postural instability?

A) subthalamic nucleus
B) pendunculopontine nucleus
C) globus pallidus interns
D) ventral intermediate nucleus of the thalamus

Placebos are often used in clinical trials of new drugs to rule out:

A) False positive results
B) Gender differences
C) False negative results
D) Harmful side effects

What cell surface molecule is a major agent in tissue rejection?

A) MHC
B) CD28
C) CD80
D) CD154

Where in the adult human body are leukocytes produced?

A) Bone marrow & Thymus
B) Thymus
C) Blood
D) Bone marrow

Which one of the following fats is unsaturated?

A) saturated fatty acids
B) octanoic acid
C) stearic acid
D) oleic acid

Which of the following cell organelles does NOT participate during cell division?

A) chromosomes
B) ribosomes
C) mitotic spindle
D) cytoplasm

Approximately how many litres of blood does the adult human body contain?

A) 2 litres
B) 5 litres
C) 10 litres
D) 15 litres

From which embryonic cell lineage does adult blood develop?

A) mesoderm
B) ectoderm
C) endoderm
D) echinoderm

If you were found to have the “Philadelphia” chromosome, what therapeutic drug would likely be prescribed?

A) Herceptin
B) Gardasil
C) Imatinib
D) Taxol

Australian Scientist Professor Elizabeth Blackburn was awarded the Nobel prize in 2009 for her contribution to our understanding of cell division and cancer. What gene did she discover?

A) BRCA1
B) Rb
C) Telomerase
D) APC

In 100 words or less describe what you think is the most significant contribution Australian researchers have made to health and medical research, and why?

A) Professor David Weisbrot, AM
B) Sir Gustav Nossal AC CBE FAA FRS
C) Professor Peter Doherty AC FAA
D) Professor Elizabeth Blackburn AC FRS

The Australian Society for Medical Research (ASMR) Medical Research Week® 2010 dates are:

A) Feb 29 – March 5
B) March 29 – April 5
C) April 29 – May 5
D) June 4 - June 11